snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans T27A3.9
sequence
CCGTCGATGACGACCAAGAGTTATCCCTGTCTGAATGATTGTGAGGACAAAAGACTATG
GTAACACTCCGAGACTA
  Box motif
  Complementary to target RNA
length 76
organism Caenorhabditis_elegans
snoRNA name T27A3.9
alias
chromosome ⁄ contig I
locus ⁄ host gene Mono:5:T27A3.9
organization Mono
target RNA 26S rRNA
modification type C/D
modification site
accession no NR_003389
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved