snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans F32E10.10
sequence
AAGCAGTGATGATTTTATAGTTCAGCTTATCTTCGGATTTGATGAGAAATTTCGCCCCT
ATCAGAGCTTT
  Box motif
  Complementary to target RNA
length 70
organism Caenorhabditis_elegans
snoRNA name F32E10.10
alias
chromosome ⁄ contig IV
locus ⁄ host gene Mono:31:F32E10.10
organization Mono
target RNA 26S rRNA
modification type C/D
modification site
accession no NR_003450
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved