snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans T03F7.8
sequence
GCCTGTGATGCTTTTCATGCGTGTCAGCTGAGATCCCCTGATTAGAACCACCCTTGAGG
TTGTATTAACTGAGGC
  Box motif
  Complementary to target RNA
length 75
organism Caenorhabditis_elegans
snoRNA name T03F7.8
alias
chromosome ⁄ contig V
locus ⁄ host gene Mono:39:T03F7.8
organization Mono
target RNA 26S rRNA
modification type C/D
modification site 26S:C2407
accession no AM051009,NR_003480
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved