snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans K02C4.7
sequence
AAGCAAATGACGAAATCGCACCTCGGCCCGACTCCAACCCTGGGGGCGAAATGAGCTTT
TTAACTCAGATGCTT
  Box motif
  Complementary to target RNA
length 74
organism Caenorhabditis_elegans
snoRNA name K02C4.7
alias
chromosome ⁄ contig II
locus ⁄ host gene Mono:13:K02C4.7
organization Mono
target RNA 18S rRNA
modification type C/D
modification site 18S:A601
accession no AM050288,NR_003410
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved