snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans T02E1.9
sequence
TCCACATGATGATACAACCATAGCATGAGCTGGCAGCAGTGATCGCTAAATGTCATAGT
TACACAGATGGG
  Box motif
  Complementary to target RNA
length 71
organism Caenorhabditis_elegans
snoRNA name T02E1.9
alias
chromosome ⁄ contig I
locus ⁄ host gene Mono:6:T02E1.9
organization Mono
target RNA
modification type C/D
modification site
accession no NR_003386
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved