snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans B0213.18
sequence
TATTGAGAGAACATACGTAAAACTAGAGTCAATGCCTTCTTTCTTGTCCTTCTCCATTT
TTACAATAAATGCGTCTACAAAATCGTCGCCTTCTTCACTGAGAGTA
  Box motif
  Complementary to target RNA
length 106
organism Caenorhabditis_elegans
snoRNA name B0213.18
alias
chromosome ⁄ contig V
locus ⁄ host gene Mono:37:B0213.18
organization Mono
target RNA 26S rRNA
modification type H/ACA
modification site 26S:U2519
accession no NR_001520
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved