snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans W05B2.9
sequence
CTGCGATGATGAGAATCATGCTAATCATGAAGAGACTCGTCAGTCTCCAACCTCCATGT
TGTAAAACAATCGATAGCTGAGCAG
  Box motif
  Complementary to target RNA
length 84
organism Caenorhabditis_elegans
snoRNA name W05B2.9
alias
chromosome ⁄ contig III
locus ⁄ host gene Mono:29:W05B2.9
organization Mono
target RNA U6 snRNA
modification type C/D
modification site U6:A48
accession no AM051024,NR_003436
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved