snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans C41C4.11
sequence
GCAATGATGTCATACTCAAATCTGTCAGTCCTCAGACCATCCCTGGTGATAACACGGTT
TTCCGGAGTGCTGAGC
  Box motif
  Complementary to target RNA
length 75
organism Caenorhabditis_elegans
snoRNA name C41C4.11
alias
chromosome ⁄ contig II
locus ⁄ host gene Mono:14:C41C4.11
organization Mono
target RNA 18S rRNA
modification type C/D
modification site 18S:C1196
accession no AM050291,NR_003405
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved