snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans T19B4.8
sequence
TGGCAATGATCGAATTATCATTGAGCCAATCCTTTTCTGAATTCTGTGAGGATGTAAAT
GATAGGTCTGAGCCA
  Box motif
  Complementary to target RNA
length 74
organism Caenorhabditis_elegans
snoRNA name T19B4.8
alias
chromosome ⁄ contig I
locus ⁄ host gene Mono:3:T19B4.8
organization Mono
target RNA 26S rRNA
modification type C/D
modification site
accession no NR_003388
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved