snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans F12F6.11
sequence
GGATTGAAGATGAAATCAACGACGCTGACCGGTAGTGATGTGTTGTCGAAACCTCTAAG
AAGTACTGACCGC
  Box motif
  Complementary to target RNA
length 72
organism Caenorhabditis_elegans
snoRNA name F12F6.11
alias
chromosome ⁄ contig IV
locus ⁄ host gene Mono:36:F12F6.11
organization Mono
target RNA 18S rRNA
modification type C/D
modification site 18S:U1342
accession no AM050838,NR_023965
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved