snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans C27H5.9
sequence
GTTGTCAGTGACGATATTACTTACCGCCCCAGGCATAGTGTTTGTGATGATTGGTTTAT
TCCGAGACTT
  Box motif
  Complementary to target RNA
length 69
organism Caenorhabditis_elegans
snoRNA name C27H5.9
alias CeN63, Cb75
chromosome ⁄ contig II
locus ⁄ host gene Poly:C27H5.10
organization Poly
target RNA 26S rRNA
modification type C/D
modification site 26S:G2731
accession no AY948696,NR_003403
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved