snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans C53B7.8
sequence
GTGTATGACGACAACATGTTAGGGACATCTGCACAAACCGTGAAGATTTAACGAAAGTA
GTACTGACACAG
  Box motif
  Complementary to target RNA
length 71
organism Caenorhabditis_elegans
snoRNA name C53B7.8
alias
chromosome ⁄ contig X
locus ⁄ host gene Mono:44:C53B7.8
organization Mono
target RNA 26S rRNA
modification type C/D
modification site 26S:C2440
accession no NR_003486
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved