snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Y74C9A.6
sequence
AGACAGAGGAGTTGATGAGAACTCTAATCCATTCTCTGAGCGAGAAGGATGGCCGAAGC
GGGTTCGCATTTGAGGCATTAAGGTAGACGACAGAGTTCTTCTGGAAACTACTGCCTCGC
GCTGACGTCATGCCTTCGCGGGCTGAATTTTGGGTCTGATCCTC
  Box motif
  Complementary to target RNA
length 163
organism Caenorhabditis_elegans
snoRNA name Y74C9A.6
alias CeN117
chromosome ⁄ contig I
locus ⁄ host gene Mono:0:Y74C9A.6
organization Mono
target RNA 26S rRNA
modification type C/D
modification site 26S:U2417
accession no AM051010,NR_001477
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved