snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans C55F2.3
sequence
GTTGTGATGATTTATTAACCATCTAAAACTAACCTCCGAAATGATATGATCGTAGTCAG
CAGGATCACAGATCACACTGACAC
  Box motif
  Complementary to target RNA
length 83
organism Caenorhabditis_elegans
snoRNA name C55F2.3
alias
chromosome ⁄ contig IV
locus ⁄ host gene Mono:32:C55F2.3
organization Mono
target RNA 26S rRNA
modification type C/D
modification site 26S:A3087
accession no NR_001504
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved