snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans H09I01.2
sequence
CTGCGGTGACGATCAACTCTTACCTACTATGACAAAAACAATGGTTAGACGTTACTCGT
ACTGTCTGAGCAG
  Box motif
  Complementary to target RNA
length 72
organism Caenorhabditis_elegans
snoRNA name H09I01.2
alias CeN14
chromosome ⁄ contig IV
locus ⁄ host gene Mono:33:H09I01.2
organization Mono
target RNA 26S rRNA
modification type C/D
modification site 26S:U2841
accession no AM051014,NR_001506
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved