snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans C16D9.10
sequence
GGGAATGATGACCTTCTGTGTAGGAATCTCAATGAGTGACTGTGACATAAAAATGCAGT
AAATTCACTGACCCC
  Box motif
  Complementary to target RNA
length 74
organism Caenorhabditis_elegans
snoRNA name C16D9.10
alias CeN122
chromosome ⁄ contig V
locus ⁄ host gene Mono:38:C16D9.10
organization Mono
target RNA 26S rRNA
modification type C/D
modification site 26S:A2429
accession no AM051011,NR_001521
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved