snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans ZK484.9
sequence
ACGCCACGTGATTTAGGTTTATTTGCTACTCTTGATTAACTCTCATGATGACAAGAAAG
TATGATGGC
  Box motif
  Complementary to target RNA
length 68
organism Caenorhabditis_elegans
snoRNA name ZK484.9
alias
chromosome ⁄ contig I
locus ⁄ host gene Mono:4:ZK484.9
organization Mono
target RNA 26S rRNA
modification type C/D
modification site 26S:A1514
accession no NR_003397
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved