snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans T06C12.16
sequence
GTGCGCGATGAACTCTTTACCATCTTTCGGGGCATAACACTCTTGATGATAACATACCC
ATTTGCTGAGCGC
  Box motif
  Complementary to target RNA
length 72
organism Caenorhabditis_elegans
snoRNA name T06C12.16
alias CeN70
chromosome ⁄ contig V
locus ⁄ host gene Mono:43:T06C12.16
organization Mono
target RNA 26S rRNA
modification type C/D
modification site 26S:G860
accession no AM050841,NR_003481
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved