snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans C04G6.12
sequence
CAGTCGAGGAGGAAAGTTTCCATGCACCACTCTGAAGGATAGTGTGGATTATGGTTCAC
AATTTACTGAGGCTGT
  Box motif
  Complementary to target RNA
length 75
organism Caenorhabditis_elegans
snoRNA name C04G6.12
alias
chromosome ⁄ contig II
locus ⁄ host gene Mono:10:C04G6.12
organization Mono
target RNA 18S rRNA
modification type C/D
modification site 18S:G1236
accession no NR_003398
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved