snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans K07C10.2
sequence
CAAGAGCTCAGACTAAGGCGTACTATTTTTCTTTTCAGCAGACCGAGGCCCTCCAAAGG
TGTCCTAAGTAAGTCATCACAACTCTTG
  Box motif
  Complementary to target RNA
length 87
organism Caenorhabditis_elegans
snoRNA name K07C10.2
alias
chromosome ⁄ contig II
locus ⁄ host gene Mono:17:K07C10.2
organization Mono
target RNA 26S rRNA
modification type C/D
modification site 26S:U2762
accession no AM051013,NR_001491
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved