snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans T10B9.11
sequence
GACAATGATAGGATAACCTAGAGTCTCTGAACCATTTCGTGTTTGCAAAAACAATGCTC
CTTGTCTGAGTC
  Box motif
  Complementary to target RNA
length 71
organism Caenorhabditis_elegans
snoRNA name T10B9.11
alias
chromosome ⁄ contig II
locus ⁄ host gene Mono:16:T10B9.11
organization Mono
target RNA 26S rRNA
modification type C/D
modification site
accession no NR_003416
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved