snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Y55F3BR.9
sequence
CGGCTGTGATGATTTCCTATTGCCGTTTACCCGTCTGAGGAAAACCGTGCTTGATACAA
CTTGGAAAAGGCTGAGCCG
  Box motif
  Complementary to target RNA
length 78
organism Caenorhabditis_elegans
snoRNA name Y55F3BR.9
alias CeN121
chromosome ⁄ contig IV
locus ⁄ host gene Mono:30:Y55F3BR.9
organization Mono
target RNA 26S rRNA
modification type C/D
modification site 26S:G2343
accession no AM050847,NR_001499
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved