snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans C46C2.8
sequence
CTGTGTATGACGACAACGTGTTAGGGACATCTGCACCAACCGTGAAGATTTAACGAAAG
TAGTACTGACACAG
  Box motif
  Complementary to target RNA
length 73
organism Caenorhabditis_elegans
snoRNA name C46C2.8
alias CeN50-1
chromosome ⁄ contig IV
locus ⁄ host gene Mono:35:C46C2.8
organization Mono
target RNA 26S rRNA
modification type C/D
modification site 26S:C2440
accession no AM051012,NR_003444
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved