snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans C18A3.12
sequence
GGCAGTGATGATCACAAATCCGTGTTTCTGACAAGCGATTGACGATAGAAAACCGGCTG
AGCCAA
  Box motif
  Complementary to target RNA
length 65
organism Caenorhabditis_elegans
snoRNA name C18A3.12
alias CeN24
chromosome ⁄ contig II
locus ⁄ host gene Mono:11:C18A3.12
organization Mono
target RNA 26S rRNA
modification type C/D
modification site 26S:A678
accession no AM050840,NR_003152
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved