snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans K02C4.8
sequence
GCGTGAGTACTGGCTGTTTGTGTCTCCGCCATTGCCAATCAGCTGTCATTAACCACGCA
ATACCGTACAGAGGTGCTAAATTACCGTGAAAACCACTTTAAAAATTGGTCACTCGGAGG
AGGCACCTCAACATTT
  Box motif
  Complementary to target RNA
length 135
organism Caenorhabditis_elegans
snoRNA name K02C4.8
alias CeN51
chromosome ⁄ contig II
locus ⁄ host gene Mono:12:K02C4.8
organization Mono
target RNA 26S rRNA
modification type H/ACA
modification site 26S:U2836
accession no AM051046,NR_003411
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved