snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans ZK265.10
sequence
GTGCAAGGATGAAAAAGAACTCTCTCACTGATAGATGATGTCTTCCTACATTATCAGAG
CAC
  Box motif
  Complementary to target RNA
length 62
organism Caenorhabditis_elegans
snoRNA name ZK265.10
alias
chromosome ⁄ contig I
locus ⁄ host gene Mono:7:ZK265.10
organization Mono
target RNA 26S rRNA
modification type C/D
modification site 26S:A395
accession no NR_003396
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved