snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana AT5G00760
sequence
TGCCGGTGATGATTTTCGTAGGCTTGTCCTGATTAAAGACATGACGTTAAACGTGAAGC
TAAGAGACTGAGGCTG
  Box motif
  Complementary to target RNA
length 75
organism Arabidopsis_thaliana
snoRNA name AT5G00760
alias
chromosome ⁄ contig 5
locus ⁄ host gene AT5G01350
organization Intronic
target RNA
modification type C/D
modification site
accession no NC_003076.8
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved