snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana AT5G01505
sequence
AGCCGTCTACAATTAAGCCGATGCTCTGGATTAAAATAGAATGAAGGAAGCATGGTACT
GTGCACGGAAACTAAACTATAGATCGACATGTCTGCCATCTCTGATTTTTCGTGATGAGA
CGGCCTGGTTTAGATCTACATTC
  Box motif
  Complementary to target RNA
length 142
organism Arabidopsis_thaliana
snoRNA name AT5G01505
alias
chromosome ⁄ contig 5
locus ⁄ host gene L7Ae/L30e/S12e/Gadd45 family
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved