snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana JKHR07A9
sequence
TGCCAAATGATGATTGAAAATTTTGCGCAAGGGTTTTGAGTTTCGGATGATTGGAGTTT
ACTCTGGTCTGAAGGAACCGTGACAAAATTATTTTCTAATAATTCATTCTGATGGCA
  Box motif
  Complementary to target RNA
length 116
organism Arabidopsis_thaliana
snoRNA name JKHR07A9
alias
chromosome ⁄ contig 3
locus ⁄ host gene Mono:JKHR07A9
organization Mono
target RNA
modification type H/ACA
modification site
accession no AY707465,NC_003074
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved