snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana R71.67
sequence
AAGCCATGATGAGGGCATTTGTTGGTGTAACCCTTGAAACGCTCCCATGCTTCACAGAA
GCTTTCACCAGCCTTCTGTATAAAGCCAGAGATCTCATTTCTGAGTCT
  Box motif
  Complementary to target RNA
length 107
organism Arabidopsis_thaliana
snoRNA name R71.67
alias
chromosome ⁄ contig
locus ⁄ host gene Mono:R71.67
organization Mono
target RNA 18S rRNA
modification type C/D
modification site 18S:A817
accession no AJ429601
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved