snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana R72b-2
sequence
TTGCAAATGATGAGTTAAATCACCATTGATAAAAGAAGCTCAATTGAGCAGTGTTGGAA
ATCTAAAACTTCCATGACTCTGATGCAA
  Box motif
  Complementary to target RNA
length 87
organism Arabidopsis_thaliana
snoRNA name R72b-2
alias
chromosome ⁄ contig 3
locus ⁄ host gene Mono:R72b-2
organization Mono
target RNA 25S rRNA
modification type C/D
modification site 25S:A1248,25S:U769
accession no AJ429609,NC_003074,AF317997,CP002686
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved