snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana R79b-2
sequence
GAAGGTGATGATGATAAAGATGAACGCTTGGGAACTTCGACTGACAGTGAGAACACTGA
ACTTTC
  Box motif
  Complementary to target RNA
length 65
organism Arabidopsis_thaliana
snoRNA name R79b-2
alias
chromosome ⁄ contig 3
locus ⁄ host gene AT3G61780
organization Intronic
target RNA 25S rRNA
modification type C/D
modification site 25S:C2319,25S:A959
accession no AJ429613,NC_003076,AF318009,CP002686
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved