snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SNOR30
sequence
TTTAATGATGATGGGGATTTTGGAGATTACGATGAGGATGTACAGCTCCCTCTTCTGAT
TAAGCTGAAGAGAATTGCTGGCAGAATCGAACCTAAATCACTAGCCACTACTGAGTT
  Box motif
  Complementary to target RNA
length 116
organism Arabidopsis_thaliana
snoRNA name SNOR30
alias
chromosome ⁄ contig 5
locus ⁄ host gene Poly:SnoR28-2a
organization Poly
target RNA 25S rRNA, 18S rRNA
modification type C/D
modification site 18S:G390,25S:A493
accession no AJ505639,NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved