snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U60.1F
sequence
CGGCAGATGATGATTTTACTTGGATTCCCCTTCAGAACATTTATGGGTGTTGCAAACTC
CAAGCTTCTGATGCT
  Box motif
  Complementary to target RNA
length 74
organism Arabidopsis_thaliana
snoRNA name U60.1F
alias
chromosome ⁄ contig 5
locus ⁄ host gene FIB1 (FIBRILLARIN 1) (FIB1)
organization Intronic
target RNA 25S rRNA
modification type C/D
modification site 25S:G2114
accession no AF228364,NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved