snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR44-3
sequence
TGCAAGTGACGATTAACAGACAGGGACATCAGAAAATATTCTGTGTTGACTATAGTCTA
TAATGGGAATCTCTCTGATGCA
  Box motif
  Complementary to target RNA
length 81
organism Arabidopsis_thaliana
snoRNA name SnoR44-3
alias
chromosome ⁄ contig 5
locus ⁄ host gene Mono:U79-3
organization Mono
target RNA 25S rRNA
modification type C/D
modification site 25S:A2316,25S:C2327
accession no NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved