snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U61-2
sequence
TGCTGTGATGTAACTACCGTGTGCCAGAGATGAAGTTATTCATCGTTGACGGCAAACAT
AACCTTAGAGTTCTAAGCT
  Box motif
  Complementary to target RNA
length 78
organism Arabidopsis_thaliana
snoRNA name U61-2
alias
chromosome ⁄ contig 1
locus ⁄ host gene Poly:U61-2
organization Poly
target RNA 25S rRNA, 18S rRNA
modification type C/D
modification site 25S:C1850,18S:A475
accession no NC_003070
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved