snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR90-2
sequence
GAGTCTTTGGGCTATGATTAGCTTTGAATGCTAATGGACTGACATCAAATAATTTTTAT
CTAAGCCGACTTTTGCAGATAGTTAGTGTAATATCTACCTGCAGACCGGTTTAGATAAAA
CATA
  Box motif
  Complementary to target RNA
length 123
organism Arabidopsis_thaliana
snoRNA name SnoR90-2
alias
chromosome ⁄ contig 2
locus ⁄ host gene plastid developmental protein DAG
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U948
accession no NC_003071
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved