snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR81-2
sequence
TACATTTTCTCCGCACATCATCTGAGGCAGATATTAATGCTTGTTTTCCTCTCTTTATG
GACTTCGAGTTTGGCTTTCTTGTCACATT
  Box motif
  Complementary to target RNA
length 88
organism Arabidopsis_thaliana
snoRNA name SnoR81-2
alias
chromosome ⁄ contig 3
locus ⁄ host gene EIF4A1 EIF4A1 (eukaryotic translation initiation factor 4A-1)
organization Intronic
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U1013
accession no NC_00307
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved