snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR80-3
sequence
ACCAATTCTGAAGGATTAAATATGGTTCCTTTAGGTATAATGGCATTGACGCAATATTG
ATTGTGGTATATCCTGATCATTTGGCTTTTTTTTCTATGTTATTTGATCCTGGAAATGCC
TCACACATT
  Box motif
  Complementary to target RNA
length 128
organism Arabidopsis_thaliana
snoRNA name SnoR80-3
alias
chromosome ⁄ contig 3
locus ⁄ host gene Poly:SnoR37-1
organization Poly
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U999,25S:U1130
accession no NC_003074
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved