snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR80-2
sequence
ACCAATTCTGAAGGATAAAAACAGTTCCTTCAGGTATAATGGCTTGTGACGCTATATTG
GTTGTGGTATATCCTGATCTTTTTGCTTTTTTCCATGCCTTTTGATCCTGGAAATGCCTC
GCACATTA
  Box motif
  Complementary to target RNA
length 127
organism Arabidopsis_thaliana
snoRNA name SnoR80-2
alias
chromosome ⁄ contig 4
locus ⁄ host gene poly:SnoR37-2
organization Poly
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U999,25S:U1130
accession no NC_003075
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved