snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR79-2
sequence
GTTTGGACTGTTACATCTCTGGTATAGAAAAGAGAGAGAAGGAAAGGCTTTTTGATGGT
TTCCATCTTTAGGTTTGGATGTCTCTTTCAAGGTGCTCATCGTTTGCTTGGTCATCTTTG
TTACGTGATGACTTGGCTCCATTTGTTCATCACAG
  Box motif
  Complementary to target RNA
length 154
organism Arabidopsis_thaliana
snoRNA name SnoR79-2
alias
chromosome ⁄ contig 1
locus ⁄ host gene AT-IE (Arabidopsis thaliana bifunctional HisI-HisE protein) (AT-IE)
organization Intronic
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U2248
accession no NC_003070
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved