snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR72-2
sequence
GAATCTCCTACAGGTCTTGCGACACAGTTAGCTTTTGATTTGATAAGCTTACTGTTACT
TTAACCCTGTTGACATTT
  Box motif
  Complementary to target RNA
length 77
organism Arabidopsis_thaliana
snoRNA name SnoR72-2
alias
chromosome ⁄ contig 5
locus ⁄ host gene resistance protein (TIR-NBS-LRR class)
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1003,18S:U1121
accession no NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved