snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR109-2
sequence
CTGTTGTACCTAGCTTAAATAAGAAGTTAATTGGCCGGTGGTCGTGAGAGAGATTTAGA
TCTCTCCGGTTGATTGTTTATTACATTTTCTGTTTTCTCACCAGT
  Box motif
  Complementary to target RNA
length 104
organism Arabidopsis_thaliana
snoRNA name SnoR109-2
alias
chromosome ⁄ contig 2
locus ⁄ host gene Mono:SnoR109-2
organization Mono
target RNA
modification type H/ACA
modification site
accession no AC006419,NC_003071
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved