snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR100-2
sequence
TAATGAATGTAGCATGGTACTGTACACGGAAACTGAACTATGGATCGACATGTCTGCCA
TCTCTGATTTTTTCCCTGATTAGACGGCCTGGTTTAGATCCACATTC
  Box motif
  Complementary to target RNA
length 106
organism Arabidopsis_thaliana
snoRNA name SnoR100-2
alias
chromosome ⁄ contig 5
locus ⁄ host gene L7Ae/L30e/S12e/Gadd45 family
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U111
accession no AL357612,NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved