snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR102-2
sequence
TGATGATTCTTAAGAAGTCAATAAACCAGACATTGTGGTAACACTCTTCTTTCATGGCG
GGGCTATAAGGAAAAAAGAGAACTCCTTTTTTTCTTTGTAAGCAGCCATGGCTGAAGAGT
TAATCCTCTAATTTGTCTGAGAAAAGGCGAATCTGAGTC
  Box motif
  Complementary to target RNA
length 158
organism Arabidopsis_thaliana
snoRNA name SnoR102-2
alias
chromosome ⁄ contig 4
locus ⁄ host gene Mono:SnoR102-2
organization Mono
target RNA 18S rRNA, U5 snRNA
modification type C/D
modification site U5:G41,18S:G1278
accession no NC_003075
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved