snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR24-pseud
sequence
CATGTGCAATTATGTATCTAGATTTATGTATGAATTTAGTCGTTTATGTACAACTGGTA
CGTTTCTTCAATGAAATACATTTGTTACGCTTGACTTCTAAGCTA
  Box motif
  Complementary to target RNA
length 104
organism Arabidopsis_thaliana
snoRNA name SnoR24-pseud
alias
chromosome ⁄ contig 4
locus ⁄ host gene Mono:U24e
organization Mono
target RNA 25S rRNA
modification type C/D
modification site 25S:C2404,25S:C2826
accession no NC_003075
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved