snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U60.2F
sequence
TTGCAAATGATGATCTTACTTGGATTCCCCTTCAGATCATTATGGGTGATGCAATCTCC
AAGTTTCTGATGTA
  Box motif
  Complementary to target RNA
length 73
organism Arabidopsis_thaliana
snoRNA name U60.2F
alias
chromosome ⁄ contig 4
locus ⁄ host gene FIBRILLARIN 2
organization Intronic
target RNA 25S rRNA
modification type C/D
modification site 25S:G2114
accession no AF228365,NC_003075
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved