snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U34d
sequence
GAGCCAATGATGATTGAAAAAGACTGCCCACATTGTTTGATTCACCACTGATATGAATT
CTATAAAGAGCTTTGTAAGA
  Box motif
  Complementary to target RNA
length 79
organism Arabidopsis_thaliana
snoRNA name U34d
alias
chromosome ⁄ contig 5
locus ⁄ host gene Mono:U34d
organization Mono
target RNA 25S rRNA
modification type C/D
modification site 25S:U1882
accession no NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved