snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U80-2
sequence
TCAAGTGATGATTAATAATGCATAGTTCAAATGATCTCCATGATTACTATTCAGTAGCA
CAGTCTTTCGCTCCTATCTGATG
  Box motif
  Complementary to target RNA
length 82
organism Arabidopsis_thaliana
snoRNA name U80-2
alias
chromosome ⁄ contig 4
locus ⁄ host gene poly:SnoR32-2
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 25S:A824,25S:U915
accession no NC_003075
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved