snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U56
sequence
AGGAAATGATGTTTATTTATTGTCATCTGATTTGCATTCCATATTTGGATGTTAAGCTG
GTGAATGATTCATTATAACTGATCCT
  Box motif
  Complementary to target RNA
length 85
organism Arabidopsis_thaliana
snoRNA name U56
alias
chromosome ⁄ contig
locus ⁄ host gene RNA recognition motif (RRM)-containing protein
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:C471
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved